[IO]
Internet Oracle
8 May 2026 home : about : create : digests : bestofs : specials : priests 12:36:05 GMT

Internet Oracularities #1111

Goto:
1111, 1111-01, 1111-02, 1111-03, 1111-04, 1111-05, 1111-06, 1111-07, 1111-08, 1111-09, 1111-10


Internet Oracularities #1111    (67 votes, 3.2 mean)
Compiled-By: Steve Kinzler <kinzler@cs.indiana.edu>
Date: Fri, 13 Aug 1999 15:21:41 -0500 (EST)

To find out all about the Internet Oracle (TM), including how to
participate, send mail to oracle@cs.indiana.edu with the word "help"
in the subject line.  ("Internet Oracle" is a trademark of Stephen
B Kinzler.)

Let us know what you like!  Send your ratings of these 10 Oracularities
on an integer scale of 1 ("very poor") to 5 ("very good") with the
volume number to oracle-vote@cs.indiana.edu (probably just reply to this
message).  For example:
   1111
   2 1 3 4 3   5 3 3 4 1

1111  67 votes 5bom5 79mk9 35pq8 1con7 6jnd6 4ngi6 76jle 6fiia bmp81 7cckg
1111  3.2 mean  3.2   3.2   3.5   3.3   2.9   3.0   3.4   3.2   2.5   3.4


1111-01    (5bom5 dist, 3.2 mean)
Selected-By: Mike Nolan <nolan@celery.tssi.com>

The Internet Oracle has pondered your question deeply. Your question was:

> ATCGGGCTTATATATAGGCCCTT
> TAGCCCGAATATATATCCGGGTT
>
> GTCATGCTAGGTCAAGTGGATTA
> CAGTACGATCCAGTTCACCTAAT
>
> GTCGGAAATGACCATTGATGCGA
> CATCCTTTACTGGTAACTACGCT
>
> GGTCGGATTAGACCAGATCAGGT
> CCTGCCTAATCTGGTCTAGTCCA

And in response, thus spake the Oracle:

} Great work! You've decoded your ENTIRE gene sequence! Hmmm . . . sorry
} to see about your genital deficiency. But, look on the bright side -
} being totally hermaphroditic can add some thrill to your sex life! And,
} don't fret - a lot of other people won't live past the age of 34
} either.


1111-02    (79mk9 dist, 3.2 mean)
Selected-By: MCHEVALIER@WELLESLEY.EDU

The Internet Oracle has pondered your question deeply. Your question was:

> Oh Oracle most wise, I've been condemned to death.  My only comfort is
> that I get to choose my method of execution.  (Except for some reason,
> they won't allow "old age".  I've already tried that one.)  So as my
> last request to you, would you please go through the various techniques
> available, list the pros and cons of each, and give your
> recommendation?

And in response, thus spake the Oracle:

} Well, there are so many ways to go that there isn't enough room to
} cover them all, but I'll do my best.
}
} 1) Death by electrocution is probably NOT a way to go. It usually takes
} three or four tries, and somewhere inbetween your eyes explode. I don't
} know about you, but I think I'd prefer to be dead BEFORE my eyes pop
} out.
}
} 2) Firing squad. This one can go a couple of ways: First, if one of the
} shooters taps you in the head, that would be a good way to go. Bullets
} travel faster than sound, so you wouldn't even have time to hear the
} guns go off. But, on the other hand, if they all aim for your body
} mass, you may actually get to witness yourself bleeding to death. For
} your final request here, you should definitely ask for a shot to the
} brain stem.
}
} 3) Lethal injection. Probably the most peaceful, tranquil, and humane
} way to die. You'll think you're going off to some blissful dream world.
} It's a pussy's way out, you coward!
}
} 4) Hanging. This is a lot like the firing squad choice: If they do it
} right, your neck, severing the spinal cord at the base of the brain.
} You'll die instantly. If they screw up, however, you will dangle from
} the end of a rope, your head supporting your entire weight for the next
} several minutes as the air is choked out of you. The pressure on your
} optic nerve will cause you to go blind (who cares, you're gonna be dead
} anyway, right) and every nerve ending in your entire body will be
} pulsing with a pain like a thousand railroad spikes are being nailed
} into you.
}
} 5) Pulled apart by wild horses.  God! That would be SO cool to watch!
}
} 6) Guillotine. Fast, little mess, but the anticipation is probably
} nerve wracking. And you can forget an open casket funeral. However, if
} you're into romantic ways to die, this probably takes the cake.
}
} 7) Gas chamber. This is a slow and agonizing way to die. Imagine
} sticking your head in an ore smelter and trying to breathe. This is the
} way that all child-molesters and rapists should die - after being
} castrated with the lid of a tuna can.
}
} 8) Self-inflicted death. At least this method allows you to set the
} pace of your departure. Again, a gun is a good choice here. It's messy,
} yes, but you won't even hear the shot go off. Sleeping pills are
} another wuss way out, and you might vomit them up before they've done
} their deed. Hanging - again, do it right or you may wind up choking to
} death.
}
} 9) Submersion chamber. This is a rather nasty contraption. You are
} strapped into an airtight chamber that ever-so-slowly fills with water.
} Here is another example where anticipation of death is almost worse
} than death itself. However, drowning is quite possibly the worst way to
} die. You are unharmed in any way, and you can breathe, but you have to
} breathe water. Your lung sacks fill with water, which you would
} normally be able to expel once your back in the atmosphere. However,
} since you are strapped into the tank, you can't expel the water, and
} your lungs fill up even more, bursting your lung sacks by the thousands
} until your lungs just stop working. If you haven't passes out, you will
} now feel like a cement truck is parked on your chest. Again, pressure
} on your optic nerve will cause blindness, and nerve endings all over
} your body will be firing like crazy. In your body's desperation to get
} air, water will get sucked through your nostrils, your ears, and your
} tear ducts - in the wrong direction. Once the water has equalized
} itself in your body, you will hear nothing, see nothing, and probably
} only taste and feel the gentle water that is killing you.
}
} 10) Death by Chocolate. My preferred method of dying. A
} chocolate-chocolate chip cookie crust, topped with chocolate ice cream,
} covered with chocolate fudge, and topped off with a chocolate graham
} cracker cookie. If I were you, I'd go out like this.
}
} You owe the Oracle some whip cream and a drool cup.


1111-03    (35pq8 dist, 3.5 mean)
Selected-By: "Forbes, Michael Scott (Scott)" <trans@lucent.com>

The Internet Oracle has pondered your question deeply. Your question was:

> Oh, most wondrous Oracle, whose stock market value only ever goes up:
>
> I'm bored.  Should I start worshipping Cthulhu, or what?

And in response, thus spake the Oracle:

} Hmmm... supplicant, you do realize that asking one diety whether
} you should start worshipping another diety is generally considered
} an act of social indiscretion with unpleasant results. Oh look, I
} even have a convenient chart of what results you can expect when
} asking one diety (y) whether you should start worshipping another
} diety (x).
}
} ==================================================================
} =           = Christian  =  Islamic   =  Oracle     =  Cthulhu   =
} =           =    God     =    God     =             =            =
} ==================================================================
} = Christian = Why'd you  =  Burn in   = Minor boils,= Burn, Burn =
} =    God    = call?      =  Hell      = painful     = in Deepest =
} =           =            =            = death       = Pit of Hell=
} ==================================================================
} =  Islamic  = Bomb in    = Have a     = email letter= Bomb at    =
} =    God    = car, basic = nice day   = bomb, minor = work, major=
} =           = damnation  =            = damnation   = damnation  =
} ==================================================================
} =           = Stops      = Bounces    = No wonder   =    *ZOT*   =
} =  Oracle   = answering  = your       = my queue is =    *ZOT*   =
} =           = questions  = e-mail     = always full =    *ZOT*   =
} ==================================================================
} =           = Devoured   = Devoured   = Devoured    = Devoured   =
} =  Cthulhu  = whole, slow= whole, slow= whole, slow = whole, slow=
} =           = digestion  = digestion  = digestion   = digestion  =
} ==================================================================
}
} So you see supplicant I'm obligated by the chart to *ZOT* you...
} but given that you are now officially registered as a follower of
} Cthulhu I suspect that you will shortly be devoured (as far as dieties
} go you picked a real winner here). I wonder if Cthulhu prefers his
} dinners rare or well done? No matter... *ZOT* *ZOT* *ZOT*


1111-04    (1con7 dist, 3.3 mean)
Selected-By: "Joshua R. Poulson" <jrp@pun.org>

The Internet Oracle has pondered your question deeply. Your question was:

> A sausage walks into a bar. The bartender says, "Sorry, but we don't
> serve food here."

And in response, thus spake the Oracle:

} Ha ha ha ha!
}
} By attempting to make me laugh, supplicant, you are now subject to the
} entire collection of bad bartender jokes!
}
} A termite walks into a bar and asks, "Is the bar tender here?"
}
} A grasshopper walks into a bar. The bartender says, "Hey, we have a
} drink named after you." The grasshopper says, "Whoa, you have a drink
} named Eddie?"
}
} A string walks into a bar. The bartender says, "Sorry, we don't serve
} strings here." The string goes outside, ties himself up, and messes up
} his ends, then returns to the bar. The bartender says, "Didn't I just
} kick you out?" To which the string replies, "I'm a frayed knot."
}
} Three vampires walk into a bar. Two of them order bloods, and the third
} orders a plasma. The bartender says, "OK, a blood, a blood, and a blood
} lite, comin' right up."
}
} A woman carrying a a duck walks into a bar. A customer says, "That's
} the ugliest pig I've ever seen." The woman says, "That's a duck, not a
} pig." The customer says, "I was talking to the duck."
}
} A mushroom walks into a bar. The bartender says, "Get outta here, we
} don't serve mushrooms!" The mushroom says, "But I'm a fun guy!"
}
} Two strings walk into a bar. The bartender says, "What'll it be?" The
} first string says, "I'll have a beer.quag fulk boorg jdk^CjfdLk jk3s
} d#f67howe%^U r89nvy~~owmc63^Dz x.xvcu" The second says, "You'lll have
} to excuse my friend, he's not null-terminated."
}
} You owe the ORACLE some new light-bulb jokes.


1111-05    (6jnd6 dist, 2.9 mean)
Selected-By: MCHEVALIER@WELLESLEY.EDU

The Internet Oracle has pondered your question deeply. Your question was:

> ......

And in response, thus spake the Oracle:

}      ______
}      |    |
}      |    O                        Guessed:  zjkqrmwxb
}      |   /|\
}      |    |                        Word #:           2
}      |   / \                       Current Average:  6.500
}    __|_____                        Overall Average:  4.000
}    |      |___
}    |_________|
}
}  Word: .r....
} Guess: s
} Sorry, the word was "oracle"
} Another word?


1111-06    (4ngi6 dist, 3.0 mean)
Selected-By: "Leo L. Schwab" <ewhac@best.com>

The Internet Oracle has pondered your question deeply. Your question was:

>  Most Grand Oracle, please accept single seater WW I fighter
>  plane as a token of my pleasure for the way you on your own
>  solve all the world's vexing riddles,
>
>  Why do crowds act so stupid?

And in response, thus spake the Oracle:

} It's a pity this is The Internet Oracle, or I'd advise you to have a
} look at the fascinating book "Influence" by Robert Cialdini, especially
} the topic of 'social proof'. But since this is The Internet Oracle, I
} won't.
}
} The real reason is of course obvious if you think about it. Which place
} in the world has the lowest IQ per person?
}
} > Houses of Parliament, in England.
}
} Close, but in actual fact the Conservative MPs only act stupid as some
} sort of machocistic game they picked up in public schools.
}
} > The Kremlin?
}
} You could be onto a winner here, but again the Russian politicians
} would be quite bright if sober. This is a bit unfair on you since no
} Russian politician has ever been sober since 1758, but false all the
} same.
}
} > Washington?
}
} Again close. But we have to give them the *occasional* point for
} getting rid of Regan.
}
} > Hollywood.
}
} Spot on the money supplicant. Now, what do people in Hollywood have
} much more of than sense?
}
} > Money.
}
} Spot on again. And what can they do with this excess money?
}
} > I dunno.
}
} Simple. Have themselves cloned.
}
} > Arrrgghhhhh!!!!
}
} That's what I thought. Look out, here come some of them now.
}
} [A crowd of John Travoltas appears and starts asking questions from one
}  of those Scientology surveys]
}
} > Orrie, save me.
}
} No worries supplicant, just show them your empty pockets.
}
} [The Travoltas disappear at high speed]
}
} > Phew. What next.
}
} Here come the Jane Fondas.
}
} [An entire crowd of Jane Fondas appears and starts 'working out' in the
} middle of the road. A fight breaks out over who should be leading the
} workout]
}
} > Orrie, is it over?
}
} Of course not, why over on that hill we have over five thousand William
} Shatners preparing to ....
}
} > NO!
}
} Yes, ....
}
} LUCY IN THE SKY WITH DIAMONDS!!!
} LUCY IN THE SKY WITH DIAMONDS!!!
} LUCY IN THE SKY WITH DIAMONDS!!!
} LUCY IN THE SKY WITH DIAMONDS!!!
} LUCY IN THE SKY WITH DIAMONDS!!!
} LUCY IN THE SKY WITH DIAMONDS!!!
}
} > Orrie, everyone's dead.
}
} Yes. Pity, isn't it. HA HAHHAHAHAHAHAHAHAHAHABWAHAHAHAHAHAHAAHAHAHA!!!!
}
} You owe Hollywood a nomination for this year's 'Darwin Award'.


1111-07    (76jle dist, 3.4 mean)
Selected-By: surfbaud@waverider.co.uk (Dave Hemming)

The Internet Oracle has pondered your question deeply. Your question was:

> Mighty Oracle, your typewriter ribbon never smears! You inkjet
> cartridges never need refilling, and even your fountain pen has never
> left a stain!
>
> Do you have any advice for a wannabe writer?

And in response, thus spake the Oracle:

}  My advice is to go into a less crowded field.
}
}  Stories about wannabes abound. Sure wannabes are cute,
}  what with their aspirations of greatness and all. And yeah,
}  the Australian Countryside is a neat setting for hopping good
}  tales about kangaroo-like critters that are pretending to
}  be what they aren't... But the wannabe market is saturated.
}  I mean look at these well know examples from the classics;
} ------------------------------------------------------------------
}
}            Of Wannabes and Men by John Outback
}
}  Eucalyptus trees littered with koala fur had trunks that held in
}  the crouches of their lower limbs debris of the sad scant rains
}  as they stood forlorn along paths beaten hard by tramps who come
}  wearily down from the billywongabongathong in the evening.
}
} "Why we always hoppin' from one spot to another, never stayin'
}  in one spot like we always trying to get somewhere we ain't
}  George?"
}
} "`Cause we're wannabes damn it Lenny! Ain't I told ya that
}   enough times yet!?! "
}
} "I'm sorry George. I'm sorry George, really I am."
} ------------------------------------------------------------------
}
}         Marsupial Island by Robert Louis Wombatson
}
}  I remember that wannabe as if it were yesterday, as he came
}  hopping to the inn door, its pouch before it like a furry
}  handbarrow; a tall, strong, heavy, nut-brown wannabe; his
}  thick tail poking out of the back of his soiled blue coat;
}  and the scar left by a killer kiwi bird cut across one
}  cheek, a dirty, livid pink. I remember him hopping `round
}  the outback and whistling to himself as he did so, and then
}  breaking out in that old beer-swilling-song that he sang so
}  often afterwards:-
}
}      `Fifteen wannabes that can never rest-
}       Yo-ho-ho, and a can of Foster's!'
} ------------------------------------------------------------------
}
}            198O Back-Forty by George Salt-Water-Crocodile
}
}      "What is your first question?"
}
}      'What have you done with my koala?' said Wannabe.
}
}       O'Heck the evil Bushwhacker smiled again. 'It betrayed you,
}       Wannabe. Immediately-unreservedly. I have seldom seen
}       a highly specialized, arboreal marsupial, restricted to a
}       diet of leaves of certain eucalyptus trees come over to us
}       so promptly.'
}
}       Wannabe was hopping mad! Surely O'Heck was lying! Not koala!
}       And he thought of the times at Noosa Heads. And he thought of
}       the rats.
} ------------------------------------------------------------------
}
}  Anyway you get the idea. Why not write about something else?
}  Wannabes have been done to death.
}
}  You owe the Oracle an oblique mention on page 42.


1111-08    (6fiia dist, 3.2 mean)
Selected-By: R.P.Clement@westminster.ac.uk (Ross Clement)

The Internet Oracle has pondered your question deeply. Your question was:

> Oh Great and Wise WOODCHUCK! oracle, Please WOODCHUCK! help this poor
> long suffering WOODCHUCK! servant. I seem to have WOODCHUCK!  picked up
> some kind of WOODCHUCK! virus in my WOODCHUCK computer that keeps
> WOODCHUCK! adding extra WOODCHUCK! words to my WOODCHUCK! messages.  I
> can't WOODCHUCK! find any WOODCHUCK! way to get it out of my WOODCHUCK!
> computer!  Can you WOODCHUCK! help me?

And in response, thus spake the Oracle:

} Sure.
}
} Go to /var/adm
}
} Find all the log files
}
} chuck them


1111-09    (bmp81 dist, 2.5 mean)
Selected-By: Dr. Noe <drnoe@primenet.com>

The Internet Oracle has pondered your question deeply. Your question was:

> O great Oracle, who never consults web-cams, because thou knowest what
> goeth on throughout the entire world anyhow. Thou for whom all pictures
> load instantly because not even a lowly 2800 baud/sec modem would dare
> make The Oracle wait to download a picture of someone's cat bowl. Thou
> who is so feared throughout the world that none would dare view your
> Lisa Changing Room Cam, despite the infinite pleasures that would
> result from sneaking a peek. That is, if thou wouldst ever be
> ungentlemanly enough to put a webcam in Lisa's changing room, which
> thou would not.
>
> Oracle, please hear this lowly charged couple device of a question from
> this measly supplicant, not even worthy of removing thy lens-cap, and
> pray tell, to answer.
>
> Oracle, I went to the page where Og's cave-cam was supposed to be, but
> the 'service' had been discontinued due to complaints. What's the
> story?

And in response, thus spake the Oracle:

} Og wasn't sure about that word "service" and he tried to service it
} himself.  He checked the dictionary first, just to make sure.  (Yes, he
} had to have Lisa help him read the definitions.  Lisa sometimes puts up
} with a lot.)  He settled on the definition that applies to cows, and
} now the camera is all euphemised up.  Believe me, you didn't want to
} see any of what happened.  (Oh, the curse of being Omniscient!)  My
} complaint was not the only one.


1111-10    (7cckg dist, 3.4 mean)
Selected-By: "Alyce Wilson" <berlin63@hotmail.com>

The Internet Oracle has pondered your question deeply. Your question was:

> Oh Oracle, who's teacakes are perfectly moist and divine and who's
> tea is always exquisitely brewed and piping hot...
>
> The conversation hovered round undiscovered and unpunished crimes.
> Everyone in turn vouchsafed an opinion:  Colonel Bantry, his plump
> amiable wife, Jane Helier, Dr. Lloyd, and even old Mrs. Wilton.
> The one person who did not speak was the one best fitted in most
> people's opinion to do so.  Sir Henry Clithering, ex-Commissioner
> of Scotland Yard, sat silent, twisting his moustache -- or rather
> stroking it -- and half smiling, as though at some inward thought
> that amused him.
>
> "Sir Henry," said Mrs. Bantry at last, "if you don't say something,
> I shall scream.  Are there a lot of crimes that go unpunished, or
> are there not?
>
> "You're thinking of newspaper headlines, Mrs. Bantry.  'Scotland Yard
> at fault again.'  And a list of unsolved mysteries to follow."
>
> "Which really, I suppose, form a very small percentage of the whole?
> said Dr. Lloyd.
>
> "I should think," said Mrs. Wilton thoughtfully, "that there must be
> a very large number."
>
> "My dear Mrs. Wilton," said Colonel Bantry.
>
> "Of course," said Mrs. Wilton, "a lot of people are stupid.  And stupid
> people get found out, whatever they do.  But there are quite a number
> of people who aren't stupid, and one shudders to think of what they
> might accomplish unless they had very strongly rooted principles."
>
> "Yes," said Sir Henry, "there are a lot of people who aren't stupid.
> How often does some crime come to light simply by reason of a bit of
> unmitigated bungling, and each time one asks oneself the question:
> If this hadn't been bungled, would anyone ever have known?
>
> ...Oh Oracle, tell us of some of the clever crimes we would otherwise
> not know....

And in response, thus spake the Oracle:

} The greatest undiscovered crimes are those that people as whole
} refuse to believe have occurred or think are not actually crimes or
} can not be accepted by humans as having happened. That being said...
}
}                Top Ten Undiscovered Crimes of All Time
}
} 10) Death of Common Sense ~400 CE
}
}     Ill for many centuries, some at first thought Common had holed up
}     somewhere and died of natural causes.  But gloating by Europe via
}     the 'Dumb is Good' so called dark ages have caused many to point
}     fingers.  Hopes that Common Sense was alive elsewhere provided
}     groundless, though some diehard fans often claim unverifiable &
}     unlikely sightings at K-marts and Swap Meets.
}
} 09) Kidnapping of the Dinosaurs ~long time ago
}
}     Unable to come up with the cash required by the Mammal Mafia and
}     unwilling to deal with the police Mother Earth sat silent as the
}     dead line for the deal passed.  The dinosaurs were dumped most
}     unceremoniously in pits and canyons around the planet, their
}     remains still turning up from time to time.
}
} 08) YAHWEH plagiarism of Sumerian texts ~2000 BCE
}
}     Bored with a go no where stint as a garden variety weather
}     god Yahweh lifted tracks verbatim from Sumerian lore and
}     passed it off as his own. Complaints by Sin and Enki were
}     filed, but laughed of by a monotheist packed court.
}
} 07) Cro-Magnon genocide of Neanderthals ~40000 BCE
}
}     In the mother of all race wars Cro-Magnon's fueled by hate
}     cave paintings and incited by the racist gruntings of one
}     "Og Orog" (no relation) the cro-mags went on a prolonged
}     world-wide rampage with an expressed goal of leaving
}     'no hat head undead'.
}
} 06) Earth Crust Vandalized by Vulcan and Neptune ~?
}
}     After a three eon ambrosia binge Vulcan and Neptune
}     took a hammer and pickaxe to the earth's crust fracturing
}     it irreparably. Though witnesses abound none will come
}     forward to testify.
}
} 05) Addiction foisted on Mankind by Television ~1950 CE
}
}     Mankind, badly disoriented by a world war, but still not
}     of age was seduced by this new vice. Countless TV addicts
}     now populate the globe unable to go more than a few hours
}     with out a fix. Many to this day still view this as a
}     victimless crime despite the slack jawed evidence that
}     litters the planet.
}
} 04) Qin swindle of Tian ~200 BCE
}
}     The Mandate of Heaven traditionally awarded to rulers that
}     actually helped their subjects was fraudulently procured
}     from its guardian Tian by Qin when the crafty con man
}     convinced the kind hearted entity that he was building
}     the Great Wall of China to keep invaders out. In truth
}     it was to keep his nomadic peoples IN.
}
} 03) Atlantis sub-Contract Swindle ~?
}
}     Use of sub-standard strata to build the continent made
}     the entire area unsafe for inhabitation. Zillions in
}     zorkmids and tons of gold vanished into the secret bank
}     accounts of those involved. Bribes to inspectors have also
}     been alleged.
}
} 02) Albert Camus murder ~1957 CE
}
}     Fears by the forces of absurdity and confusion came to
}     an ugly head with the hit on Albert Camus. Camus viewed
}     as on the verge of spreading his ideas of 'morality with
}     out immortality' to the masses threatened to return ideas
}     too similar to those of Common Sense [see 1] to world use.
}
} 01) Windows GUI ~1970 CE
}
}     No explanation needed. Investigation ongoing.


© Copyright 1989-2026 The Internet OracleTM a Kinzler.com offering Contact oracle-web@internetoracle.org